Analysis of 5' and 3' snoRNA termini maturation in ...

Analysis of 5' and 3' snoRNA termini maturation in ...

7th Asia Pacific Biotech Congress 2015, Young Researchers Forum Beijing, 13th of July 2015 Analysis of 5 and 3 snoRNA termini maturation in Saccharomyces cerevisiae A N E TA MAT U SZE K I N S T I T U T E O F G E N E T I C S A N D B I O T E C H N O LO GY U N I V E R S I T Y O F WA R S AW , P O L A N D S U P E RV I S O R: P R O F. J OA N N A KU F E L Presentation agenda Introduction to snoRNA biology structure and function of snoRNA snoRNA genes organization snoRNA processing model Aims of the study Materials strains characterization snoRNA molecules Results Conclusions 7th Asia Pacific Biotech Congress 2015, Young Researchers Forum snoRNA: structure and functions Box C/D snoRNA: 2-O-methylation (Me) of rRNA GA U C Box D

Me GA AU UG 5 C/D snoRNA target RNA box H/ACA snoRNA: pseudouridylation (N) of rRNA) of rRNA Proteins: Fibrillarin/Nop1 Nop56 Nop58 15.5-kD Box C Proteins: Nhp2 Nop10 Cbf5 (dyskerin) Gar1 H/ACA snoRNA N) of rRNA 3

N) of rRNA 5 3 Box D GA CU Box C GA U A UG 3 5 Me target RNA 5 target RNA 5 ANANNA Box H

7th Asia Pacific Biotech Congress 2015, Young Researchers Forum ACA Box ACA NNN 3 Organization of snoRNA genes monocistronic P P yeast plants Metazoa independent genes yeast animals plants pre-mRNA introns intronic P exon

exon exon policistronic P yeast plants 7th Asia Pacific Biotech Congress 2015, Young Researchers Forum policistronic transcripts Model of snoRNA processing AAAAAAAAAAA AAAAAAAAAAA Szczepaniak, not published TRAMP: nuclear surveillance Trf4/5 poly(A) polymerase + Air1/2 + Mtr4

RNA binding proteins RNA DEVH helicase 7th Asia Pacific Biotech Congress 2015, Young Researchers Forum Coupling of 5 and 3 snoRNA end formation in yeast Factors involved in transcription termination and formation of mRNA 3 end associate with the promoter region coupling of transcription and mRNA ends processing [Topisirovic, 2011] Cap-binding and Nrd1/Nab3/Sen1 complexes copurify, suggesting interaction of machineries acting on both snoRNA ends [Vasiljeva, 2006] Interaction between CBC and Nrd1-Nab3 is direct [Szczepaniak, not published] CBC remains associated at snoRNA genes until transcription termination [Szczepaniak, not published] Rnt1 is recruited to maturing snoRNAs at late stages of transcription [Szczepaniak, not published] 7th Asia Pacific Biotech Congress 2015, Young Researchers Forum Aim of the study Hypothesis: Processing of 5 and 3 snoRNA ends in Saccharomyces cerevisiae is coupled. Analysis of snoRNA 3 and 5 end status in mutants with defective end formation: cRT-PCR analysis Description of snoRNA synthesis defects in mutant strains: northern blot analysis. Characterization of an alternative 5 pre-snoRNA formation mechanism by Dcp1/Dcp2-dependent cap hydrolysis in the absence of Rnt1 cleavage: nothern blot analysis. 7th Asia Pacific Biotech Congress 2015, Young Researchers Forum Materials (1): Strain

Genotype References BY 4741 MATa his31, leu20, met150, ura30 Euroscarf BMA 64 MATa, ura3-1, ade2-1, his3-11,15, trp1, leu2-3,112, can1-100 Baudin, 1993 rnt1 as BMA64 but RNT1::TRP1 Chanfreau, 1998 cbp80 MATa, ade2, ade3, his3, leu2-3, 112 rp1 ura3 CBP80::TRP1 Fortes, 1999 tgs1 as BMA64 but TGS1:: HIS3

Mouaikel, 2002 rnt1 cbp80 as rnt1 but CBP80::HIS3 Szczepaniak rnt1 tgs1 as rnt1 ale TGS1::HIS3 Szczepaniak dcp2 leu2-3112 his4-539 lys2-201 trp1 ura3-52 DCP2::TRP1 Dunckley, 1999 BMA64 + pRS415-snR68WT as BMA64 but pRS415-snR68WT Szczepaniak BMA64 + pRS415-snR68mut as BMA63 but pRS415-snR68mut Szczepaniak cbp80 + pRS415-snR68WT

as cbp80 but pRS415-snR68WT Szczepaniak cbp80 + pRS415-snR68mut as cbp80 but pRS415-snR68mut Szczepaniak tgs1 + pRS415-snR68WT as tgs1 but pRS415-snR68WT Szczepaniak tgs1 + pRS415-snR68mut as tgs2 but pRS415-snR68mut Szczepaniak dcp2 + pRS415-snR68WT as dcp2 but pRS415-snR68WT Szczepaniak dcp2 pRS415-snR68mut 7th Asia Pacific Biotech Congress 2015,+Young Researchers Forum as dcp2 but pRS415-snR68mut

Szczepaniak yeast strains used in the study Rnt1 homologous to bacterial Rnase III, double-strandspecific endoribonuclease, functions in the 5-end processing of some C/D box snoRNA, substrates are capped by tetraloops with the consensus AGNN sequence. Tgs1 nuclear trimethyl guanosine synthase I, responsible for m7G RNA cap hypermethylation to m2,2,7G (TMG) cap of sn/snoRNA. Cbp80 - 80 kDa nuclear cap-binding protein, both with Cbp20 are subunits of the cap-binding complex Dcp1/Dcp2 complex responsible for rapid RNA decapping by removing the 5 cap and leaving the 5 end susceptible to exonucleolytic degradation Materials (2): study snoRNA molecules under Independently transcribed box C/D snoRNAs cleaved by Rnt1 (with a AGNN-capped stem-loop structure recognized by Rnt1) snR68 snR64 snR65 Independently transcribed C/D box snoRNA with a TMG cap, not processed at the 5 end snR13 (control) Chanfreau et al. 2000 7th Asia Pacific Biotech Congress 2015, Young Researchers Forum

Results 7th Asia Pacific Biotech Congress 2015, Young Researchers Forum 5 pre-snoRNA maturation defects lead to the accumulation 3-extended precursors RNase H oligo1 3 5 oligo2 3 5 Northern blot analysis for snR68 and snR64 molecules in wt and mutant strains. Hybridization after RNase H treatment in the presence of oligo complementary to the mature snoRNA (100-200 bp upstream 3 end) 7th Asia Pacific Biotech Congress 2015, Young Researchers Forum 3-presnR68 mature snR68

3-presnR64 mature snR64 snR13 Deficiency of 5 end maturation affects the 3 pre-snoRNA end status snR68 cRT-PCR analysis Ligation after decapping by RNase H. Reverse trascription of circulated RNA (68RTLig or 68RTg) 136 bp 68HLig Rnt1 Sn68pre5 68PCR 2R 68RTg (1R) 68RTLig 68PCRlig (2F) 68PCR 1F snR68 molecule; 68RTg and 68PCR 1F

Mature form: 136 bp Accumulation of 3-extended precursors, not cleaved by Rnt1, in strains with defects in 5-end maturation. 500bp 200bp 7th Asia Pacific Biotech Congress 2015, Young Researchers Forum Dcp1/Dcp2 complex plays a role in presnoRNA processing an alternative maturation pathway Accumulation of 3-extended precursors in decapping mutants (dcp1 or dcp2) Northern blot analysis for snR68, snR64 and snR65 wt* BY4741 3-presnR68 25C transfered to 37C for 1h (136 bp) mature snR68 snR13 The effect is visibile only for snR68 differences in the dependence on Rnt1 clevage? Accumulation of snR68 precursors in rnt1 and dcp2 rnt1 dcp1 and rnt1 dcp2 - lethal

G G A A A- U U- A G- C U- A U U UG Gmutation A G C CU GG CC U G -UA AC A U CU UCG U A GAC CAU C G- G U G 5 - A - - 87 nt - 3 C C A A A A- U

U- A G- C U- A U U UG GA G C CU GG CC U G -A U AC Not cleaved AU by Rnt1 C U UG C U A GAC C AU C G U- G G - - 87 nt - 3 5 - A C Accumulation of precursors in strains with pRS415snR68wt/mut (mutation in the Rnt1 recognition motif:

AGGAACAA). BMA64 (wt for Rnt1 mutants) and BY4741 (wt* for Dcp1/Dcp2 mutants) 7th Asia Pacific Biotech Congress 2015, Young Researchers Forum presnR68 mature snR68 snR13 5-end extensions in rnt1 and dcp2 Sequencing after cRT-PCR: ~90% of precursors accumulated in dcp2 are not cleaved by Rnt1, but have shorter 5 ends than observed in rnt1 strains length (nt) strain BMA6 GTGTTTCTGAAAGGGACCTTCAGGAGGTTACGATCAAGTATCTTGTGACATGCAAGAA 60 rnt1 cbp80 tgs1

---TTTCTGAAAGGGACCTTCAGGAGGTTACGATCAAGTATCTTGTGACATGCAAGAA -----------------------------ACGATCAAGTATCTTGTGACATGCAAGAA ------------------------------CGATCAAGTATCTTGTGACATGCAAGAA 55 29 28 GTGTTTCTGAAAGGGACCTTCAGGAGGTTACGATCAAGTATCTTGTGACATGCAAGAA -----------------CTTCAGGAGGTTACGATCAAGTATCTTGTGACATGCAAGAA ----------------------GGAGGTTACGATCAAGTATCTTGTGACATGCAAGAA -------------------------GGTTACGATCAAGTATCTCGTGACATGCAAGAA -----------------------------ACGATCAAGTATCTTGTGACATGCAAGAA ------------------------------CGATCAAGTATCTTGTGACATGCAAGAA 58 41 36 33 29 28 -----------------CTTCAGGAGGTTACGATCAAGTATCTTGTGACATGCAAGAA 41 number of clones (2) rnt1

Alternative transtcription start site? Alternative decapping enzyme? WT (2) (2) dcp1 ----------------------GGAGATTACGATTAAGTATCTTGTGACATGCAAGAA 36 (2) -------------------------GATTACGATTAAGTATCTTGTGACATGCAAGAA 33 -----------------------------ACGATTAAGTATCTTGTGACATGCAGGAA 29 (4) ------------------------------CGATTAAGTATCTTGTGACATGCAAGAA 28 7th Asia Pacific Biotech Congress 2015, Young Researchers Forum Conclusions Defects of 5 snoRNA end processing, especially lack of Rnt1 cleavage, lead to inefficient 3 end formation and accumulation of extended precursors. This phenotype is additionally modulated by mutations of other proteins acting at snoRNA 5 ends: it is partly rescued by the absence of CBC and additionally strenghtened by deletion of Dcp1/Dcp2 or Tgs1 Synthesis of mature snoRNAs in the absence of Rnt1 cleavage suggests the existance of an alternative maturation pathway mediated by the Dcp1/Dcp2 complex and independent of Rnt1 7th Asia Pacific Biotech Congress 2015, Young Researchers Forum

Acknowledgments Joanna Kufel, Prof. Sylwia Szczepaniak, MSc Anna Pastucha, PhD Karolina Stpniak, MSc And all other members of Kufels RNA lab Thank you for your attention! Literature Chanfreau G, Legrain P, Jacquier A. (1998). Yeast RNase III as a key processing enzyme in small nucleolar RNAs metabolism. J. Mol. Biol. 284:975-988. Chanfreau G, Buckle M, Jacquier A. (2000). Recognition of conserved class of RNA tetraloops by Saccharomyces cerevisiae RNase III. Proc. Natl. Acad. Sci. U.S.A. 97(7):3142-7. Grzechnik P, Kufel J. (2008). Polyadenylation linked to transcription termination directs the processing of snoRNA precursors in yeast. Mol. Cell 32:247-258. Kim M, Krogan NJ, Vasiljeva L, Rando OJ, Nedea E, Greenblatt JF, Buratowski S. (2004). The yeast Rat1 exonuclease promotes transcription termination by RNA polymerase II. Nature 432:517 522. Kiss T. (2002). Small Nucleolar RNAs: An abundant group of noncoding RNAs with diverse cellular functions. Cell 109:145-148. Kuehner JN, Pearson EL, Moore C. (2011). Unravelling the means to an end: RNA polymerase II transcription termination. Nat. Rev. Mol. Cell. Biol. 12:283-294. LaCava J, Houseley J, Saveanu C, Petfalski E, Thompson E, Jacquier A, Tollervey D. (2005). RNA degradation by the exosome is promoted by a nuclear polyadenylation complex. Cell 121:71324. Lee CY, Lee A. i Chanfreau G. (2003). The roles of endonucleolytic cleavage and exonucleolytic digestion in the 5-end processing of S. cerevisiae box C/D snoRNAs. RNA 9:1362-1370. Matera AG, Terns RM, Terns MP. (2007). Non-coding RNAs: lessons from the small nuclear and small nucleolar RNAs. Nat. Rev. Mol. Cell. Biol. 8:209-220 Mouaikel J, Verheggen C, Bertrand E, Tazi J, Bordonne R. (2002). Hypermethylation of the cap structure of both yeast snRNAs and snoRNAs requires a conserved methyltransferase that is localized to the nucleolus. Mol. Cell 9:891-901. Vasiljeva L, Kim M, Mutschler H, Buratowski S, Menhart A. (2008). The Nrd1-Nab3-Sen1 termination complex interacts with the Ser5-phosphorylated RNA polymerase II C-terminal domain. Nat. Struct. Mol. Biol. 15(8):795-804. Samarsky, D.A. and Fournier, M.J. (1999). A comprehensive database for the small nucleolar RNAs from Saccharomyces cerevisiae. Nucleic Acids Res 27: 161164. 7th Asia Pacific Biotech Congress 2015, Young Researchers Forum

Recently Viewed Presentations

  • An Active Audience: Just one or many? Michele

    An Active Audience: Just one or many? Michele

    An Active Audience: Just one or many? Michele Morehouse. This Final Project is Submitted in Partial Fulfillment of the Requirements for the Master of Arts Degree
  • ELA-b Read180 4/3/18

    ELA-b Read180 4/3/18

    "Lose Now, Pay Later" by Carol Farley. Deb. Trinja. Trevor. In 2041, Deb and Trinja discover a new treat at the mall named Swoodies. They eat a lot and gain weight. They go to the mall again and see there's...
  • Dollar Tree - Weebly

    Dollar Tree - Weebly

    Dollar Tree is the largest bargain retailer in North America with the financial strength and vision to continue to grow. Dollar Tree is a great place to bargain shop. Dollar Tree has good benefits for managers and above which makes...
  • Maltese Culture and Folklore - WordPress.com

    Maltese Culture and Folklore - WordPress.com

    Matisse, Open Window, Collioure, 1905,National. Maltese . village . snd. sleeping lady and Fishing village sunrise . These two paintings are showing Maltese culture and lifestyle but in a simplified and abstract form. It is possible that the artist was...
  • The intrepid researcher: Evaluating programmes and social interventions

    The intrepid researcher: Evaluating programmes and social interventions

    Mary Dixon-Woods. Department of Health Sciences. University of Leicester. Why intervene. Because there is a problem to be addressed. Because there is a reasonable basis for thinking that it can be addressed, for reasonable cost and with minimal damage.
  • SAT List #15

    SAT List #15

    (adj) hostile to the point of being venomous; intensely acrimonious (SAT synonym- vitriolic) 7. The guilty verdict was passed despite vociferous objections from the defendant. (adj) making a noisy, vehement outcry 8. The wistful girl recalled poignant memories from her...
  • Excerpts from the play Macbeth Vocabulary  Tragedy -

    Excerpts from the play Macbeth Vocabulary Tragedy -

    About the Play. Shakespeare's Macbeth is one of many plays that were based on historical events. Macbeth. was also written with the intent to satisfy Shakespeare's primary patron: King James of Scotland. James was fascinated with Scottish history and was...
  • Mary & Saints - Catholic Resources

    Mary & Saints - Catholic Resources

    Most Holy Virgin Mary, Help of Christians, we place ourselves under your motherly protection. Throughout history you have helped Christians in times of trial, temptation and danger. Time and time again, you have proven to be the Refuge of sinners,...